Skip to content

GitLab

Commit d67a9e22 authored by Roman Sarrazin-Gendron's avatar Roman Sarrazin-Gendron
Browse files

merging:wq

parent 3dfc0b7a
Hide whitespace changes
Inline Side-by-side
src/dot.ps deleted 100644 → 0
View file @ 3dfc0b7a
%!PS-Adobe-3.0 EPSF-3.0
%%Title: RNA Dot Plot
%%Creator: ViennaRNA-2.4.3
%%CreationDate: Fri Feb 9 20:36:33 2018
%%BoundingBox: 0 0 700 720
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments
%Options:
%This file contains the square roots of the base pair probabilities in the form
% i j sqrt(p(i,j)) ubox
%%BeginProlog
/DPdict 100 dict def
DPdict begin
/logscale false def
/lpmin 1e-05 log def
/DataVisible [ true true true true] def
/DataTitles [ false false false false ] def
/min { 2 copy gt { exch } if pop } bind def
/max { 2 copy lt { exch } if pop } bind def
/box { %size x y box - draws box centered on x,y
2 index 0.5 mul sub % x -= 0.5
exch 2 index 0.5 mul sub exch % y -= 0.5
3 -1 roll dup rectfill
} bind def
/ubox {
logscale {
log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
} if
3 1 roll
exch len exch sub 1 add box
} bind def
/lbox {
3 1 roll
len exch sub 1 add box
} bind def
/drawseq {
% print sequence along all 4 sides
[ [0.7 -0.3 0 ]
[0.7 0.7 len add 0]
[-0.3 len sub -0.4 -90]
[-0.3 len sub 0.7 len add -90]
] {
gsave
aload pop rotate translate
0 1 len 1 sub {
dup 0 moveto
sequence exch 1 getinterval
show
} for
grestore
} forall
} bind def
/drawgrid{
gsave
0.5 dup translate 0.01 setlinewidth
len log 0.9 sub cvi 10 exch exp % grid spacing
dup 1 gt {
dup dup 20 div dup 2 array astore exch 40 div setdash
} { [0.3 0.7] 0.1 setdash } ifelse
0 exch len {
dup dup
0 moveto
len lineto
dup
len exch sub 0 exch moveto
len exch len exch sub lineto
stroke
} for
[] 0 setdash
0.04 setlinewidth
currentdict /cutpoint known {
cutpoint 1 sub
dup dup -1 moveto len 1 add lineto
len exch sub dup
-1 exch moveto len 1 add exch lineto
stroke
} if
%% draw diagonal
0 len moveto len 0 lineto stroke
grestore
} bind def
/drawTitle {
currentdict /DPtitle known {
% center title text
/Helvetica findfont 10 scalefont setfont
360 705 moveto DPtitle dup stringwidth pop 2 div neg 0 rmoveto show
} if
} bind def
/prepareCoords {
0 1 3 {
% check whether we want to display current data
dup DataVisible exch get
{
% check whether we've actually got some data
DataSource exch get dup currentdict exch known {
% data source s_j is present, so find length of array
currentdict exch get length
} { pop 0 } ifelse
} if
} for
exch dup 5 -1 roll add 4 -1 roll dup 5 1 roll 4 -1 roll add max
len add 3 add 700 exch div dup scale
exch 1 add exch 1 add translate
} bind def
/utri{ % i j prob utri
gsave
0.5 dup translate
1 min 2 div
0.85 mul 0.15 add 0.95 0.33
3 1 roll % prepare hsb color
sethsbcolor
% now produce the coordinates for lines
exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
moveto lineto lineto closepath fill
grestore
} bind def
/uUDmotif{ % i j uUDmotif
gsave
0.5 dup translate
1 min 2 div
0.85 mul 0.15 add 0.95 0.6
3 1 roll % prepare hsb color
sethsbcolor
% now produce the coordinates for lines
exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
moveto lineto lineto closepath fill
grestore
} bind def
/lUDmotif{ % i j lUDmotif
gsave
0.5 dup translate
1 min 2 div
0.85 mul 0.15 add 0.95 0.6
3 1 roll % prepare hsb color
sethsbcolor
% now produce the coordinates for lines
dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub
moveto lineto lineto closepath fill
grestore
} bind def
/uHmotif{ % i j uHmotif
gsave
0.5 dup translate
1 min 2 div
0.85 mul 0.15 add 0.95 0.99
3 1 roll % prepare hsb color
sethsbcolor
% now produce the coordinates for lines
exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
moveto lineto lineto closepath fill
grestore
} bind def
/lHmotif{ % i j lHmotif
gsave
0.5 dup translate
1 min 2 div
0.85 mul 0.15 add 0.95 0.99
3 1 roll % prepare hsb color
sethsbcolor
% now produce the coordinates for lines
dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub
moveto lineto lineto closepath fill
grestore
} bind def
/uImotif{ % i j k l uImotif
gsave
0.5 dup translate
1 min 2 div
0.85 mul 0.15 add 0.95 0.99
3 1 roll % prepare hsb color
sethsbcolor
% now produce the coordinates for lines
1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup
5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll
moveto lineto lineto lineto closepath fill
grestore
} bind def
/lImotif{ % i j k l lImotif
gsave
0.5 dup translate
1 min 2 div
0.85 mul 0.15 add 0.95 0.99
3 1 roll % prepare hsb color
sethsbcolor
% now produce the coordinates for lines
4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch
5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll
moveto lineto lineto lineto closepath fill
grestore
} bind def
/drawDataSquareBottom { % x v n dataSquareBottom draw box
len add 2 add exch lbox
} bind def
/drawDataSquareTop { % x v n dataSquareBottom draw box
neg 1 sub exch lbox
} bind def
/drawDataSquareLeft { % y v n dataSquareBottom draw box
neg 1 sub 3 1 roll lbox
} bind def
/drawDataSquareRight { % y v n dataSquareBottom draw box
% use size x y box to draw box
2 add len add 3 1 roll lbox
} bind def
/drawDataSquareBottomHSB { % x v h s b n dataSquareBottomHSB draw box
% use size x y box to draw box
len add 2 add 5 1 roll sethsbcolor lbox
} bind def
/drawDataSquareTopHSB { % x v h s b n dataSquareBottomHSB draw box
% use size x y box to draw box
neg 1 sub 5 1 roll sethsbcolor lbox
} bind def
/drawDataSquareLeftHSB { % x v h s b n dataSquareLeftHSB draw box
% use size x y box to draw box
neg 1 sub 6 1 roll sethsbcolor lbox
} bind def
/drawDataSquareRightHSB { % x v h s b n dataSquareLeftHSB draw box
% use size x y box to draw box
2 add len add 6 1 roll sethsbcolor lbox
} bind def
/drawDataTitleBottom {
/Helvetica findfont 0.95 scalefont setfont
0 -1.4 3 -1 roll sub moveto
dup stringwidth pop neg 0 rmoveto
show
} bind def
/drawDataTitleTop {
/Helvetica findfont 0.95 scalefont setfont
0 len 1.6 add 3 -1 roll add moveto
dup stringwidth pop neg 0 rmoveto
show
} bind def
/drawDataTitleLeft {
/Helvetica findfont 0.95 scalefont setfont
neg 1.4 sub len 1 add moveto
dup stringwidth pop 0 exch rmoveto -90 rotate
show 90 rotate
} bind def
/drawDataTitleRight {
/Helvetica findfont 0.95 scalefont setfont
1.6 add len add len 1 add moveto
dup stringwidth pop 0 exch rmoveto -90 rotate
show 90 rotate
} bind def
% do not modify the arrays below unless you know what you're doing!
/DataSource [ /topData /leftData /bottomData /rightData ] def
/DataDrawBox [ /drawDataSquareTop /drawDataSquareLeft /drawDataSquareBottom /drawDataSquareRight] def
/DataDrawBoxHSB [ /drawDataSquareTopHSB /drawDataSquareLeftHSB /drawDataSquareBottomHSB /drawDataSquareRightHSB ] def
/DataDrawTitle [ /drawDataTitleTop /drawDataTitleLeft /drawDataTitleBottom /drawDataTitleRight ] def
% this is the logic to parse the auxiliary linear data
% given in arrays topData, leftData, bottomData, and rightData
% See also the Boolean arrays DataVisible and DataTitles that
% are used to control which part of data will be visible
/drawData {
0 1 3 {
% check whether we want to display current data
dup DataVisible exch get
{
% check whether we've actually got some data
dup DataSource exch get dup currentdict exch known {
% data source s_j is present, so we load the
% corresponding data array a and loop over all data sets a[i]
currentdict exch get dup length 1 sub 0 1 3 -1 roll {
dup dup
% now on stack: j a i i i
% load data set, i.e. a[i]
4 -1 roll % j i i i a
dup 3 -1 roll get dup % j i i a a[i] a[i]
% 1. check whether we need to process data set title
6 -1 roll dup 7 1 roll DataTitles exch get {
% get current title drawing function key
6 -1 roll dup 7 1 roll DataDrawTitle exch get
% now on stack: ... j i i a a[i] a[i] title_draw_key
% get current title and execute drawing function
exch 0 get exch currentdict exch get 5 -1 roll exch exec
} { % remove unused variables
pop 3 -1 roll pop
} ifelse
% now on stack: ... j i a a[i]
% 2. process actual data a[k] for 1 <= k < n
dup length 1 sub 1 exch getinterval {
% on stack: j i a a[i][k]
gsave
dup length 2 eq { % print black box if two-valued
% get box drawing function
4 -1 roll dup 5 1 roll DataDrawBox exch get currentdict exch get exch
aload pop 5 -1 roll dup 6 1 roll 4 -1 roll exec
} {
dup length 5 eq { % print box with hsb color
% get box drawing function
4 -1 roll dup 5 1 roll DataDrawBoxHSB exch get currentdict exch get exch
% on stack: j i a f a[i]
% load data array and prepare for drawing
aload pop 8 -1 roll dup 9 1 roll 7 -1 roll exec
} { pop } ifelse
} ifelse
grestore
} forall
exch pop
% left on stack: j a
} for
} if
} if
} for
} bind def
end
%EndProlog
DPdict begin
/DPtitle {
(dot.ps)
} def
/sequence { (\
AAAAUGUAUGUAUAUUGUAUGUUAUAUAUUUGUAAAGAUGAGUAUUGUAUAAAAUGUAUA\
) } def
/len { sequence length } bind def
% BEGIN linear data array
/topData [
] def
/leftData [
] def
/bottomData [
] def
/rightData [
] def
% END linear data arrays
%Finally, prepare canvas
%draw title
drawTitle
%prepare coordinate system, draw grid and sequence
/Helvetica findfont 0.95 scalefont setfont
%prepare coordinate system
prepareCoords
%draw sequence arround grid
drawseq
%draw grid
drawgrid
%draw auxiliary linear data (if available)
drawData
%data (commands) starts here
%start of quadruplex data
%start of Hmotif data
%start of Imotif data
%start of base pair probability data
50 54 0.008887900 ubox
1 18 0.005909369 ubox
1 23 0.003370084 ubox
1 25 0.017743395 ubox
1 27 0.003537936 ubox
1 30 0.015539868 ubox
1 31 0.055730642 ubox
1 33 0.063126232 ubox
1 39 0.008565111 ubox
2 7 0.004682127 ubox
2 16 0.003223916 ubox
2 23 0.007223698 ubox
2 25 0.009878791 ubox
2 27 0.004563351 ubox
2 29 0.018201442 ubox
2 30 0.053086443 ubox
2 31 0.833045163 ubox
2 33 0.049631186 ubox
2 39 0.009505543 ubox
3 16 0.041405710 ubox
3 22 0.005789865 ubox
3 23 0.104874393 ubox
3 27 0.004100198 ubox
3 29 0.040726638 ubox
3 30 0.882081903 ubox
3 31 0.054456207 ubox
3 33 0.035867802 ubox
3 39 0.007751120 ubox
4 11 0.004011755 ubox
4 13 0.006687771 ubox
4 15 0.044118265 ubox
4 20 0.006734004 ubox
4 22 0.114507748 ubox
4 25 0.017702265 ubox
4 27 0.077015475 ubox
4 29 0.894168730 ubox
4 30 0.049638590 ubox
4 31 0.067670722 ubox
4 33 0.254127142 ubox
4 39 0.025883649 ubox
4 59 0.006182292 ubox
5 10 0.003965978 ubox
5 12 0.006886833 ubox
5 14 0.044567088 ubox
5 19 0.006956152 ubox
5 21 0.115675993 ubox
5 24 0.018438439 ubox
5 26 0.081708865 ubox
5 28 0.896568311 ubox
5 32 0.258891564 ubox
5 34 0.056242094 ubox
5 35 0.016860540 ubox
5 36 0.014197987 ubox
5 37 0.005673453 ubox
5 38 0.026351147 ubox
5 40 0.011811537 ubox
5 41 0.006231209 ubox
5 58 0.006356371 ubox
5 60 0.008409786 ubox
6 11 0.005942074 ubox
6 13 0.044220445 ubox
6 15 0.006331729 ubox
6 18 0.006715419 ubox
6 20 0.118862472 ubox
6 23 0.017830037 ubox
6 25 0.083071788 ubox
6 27 0.897246957 ubox
6 29 0.169069840 ubox
6 30 0.026847788 ubox
6 31 0.193338644 ubox
6 33 0.058814333 ubox
6 39 0.025071221 ubox
6 57 0.005385538 ubox
6 59 0.010067986 ubox
7 12 0.042132121 ubox
7 14 0.006769109 ubox
7 17 0.006805780 ubox
7 19 0.119531304 ubox
7 21 0.006948722 ubox
7 24 0.082664126 ubox
7 26 0.897280969 ubox
7 28 0.179906214 ubox
7 32 0.066366391 ubox
7 34 0.045058659 ubox
7 35 0.005390327 ubox
7 36 0.020541380 ubox
7 37 0.003269550 ubox
7 38 0.025510513 ubox
7 40 0.025232911 ubox
7 58 0.010095603 ubox
7 60 0.003311236 ubox
8 13 0.006166554 ubox
8 16 0.007073222 ubox
8 18 0.119513499 ubox
8 20 0.008309767 ubox
8 22 0.070050919 ubox
8 23 0.067311702 ubox
8 25 0.895399547 ubox
8 27 0.181818086 ubox
8 29 0.325510508 ubox
8 30 0.012562367 ubox
8 31 0.069525162 ubox
8 33 0.047412097 ubox
8 39 0.027506329 ubox
8 57 0.008293319 ubox
8 59 0.003742957 ubox
9 17 0.118620974 ubox
9 19 0.008984295 ubox
9 21 0.093983484 ubox
9 24 0.890711931 ubox
9 26 0.182381851 ubox
9 28 0.338599140 ubox
9 32 0.045258692 ubox
9 34 0.006164975 ubox
9 35 0.004582034 ubox
9 36 0.008655144 ubox
9 37 0.003577054 ubox
9 38 0.027309980 ubox
9 58 0.003662661 ubox
10 15 0.003675175 ubox
10 16 0.103637893 ubox
10 18 0.009066959 ubox
10 20 0.161846597 ubox
10 22 0.088655786 ubox
10 23 0.840571953 ubox
10 25 0.183163087 ubox
10 27 0.343034878 ubox
10 29 0.102471897 ubox
10 30 0.003826020 ubox
10 31 0.017826589 ubox
10 33 0.005265502 ubox
10 59 0.003678405 ubox
11 17 0.014842201 ubox
11 19 0.186234925 ubox
11 21 0.165970516 ubox
11 24 0.182990188 ubox
11 26 0.343721930 ubox
11 28 0.108963901 ubox
11 32 0.004604307 ubox
11 34 0.039363126 ubox
11 36 0.023459624 ubox
11 40 0.004088425 ubox
11 58 0.003696230 ubox
12 16 0.012808219 ubox
12 18 0.185524347 ubox
12 20 0.259500397 ubox
12 22 0.754374739 ubox
12 23 0.165467603 ubox
12 25 0.343916690 ubox
12 27 0.109572836 ubox
12 29 0.020447863 ubox
12 31 0.004602921 ubox
12 33 0.041234905 ubox
12 39 0.004450548 ubox
12 57 0.003550184 ubox
13 17 0.171858792 ubox
13 19 0.261975277 ubox
13 21 0.773200143 ubox
13 24 0.343991303 ubox
13 26 0.109667854 ubox
13 28 0.020729151 ubox
13 32 0.041177006 ubox
13 34 0.025331127 ubox
13 38 0.004283552 ubox
13 40 0.005747986 ubox
14 18 0.232969552 ubox
14 20 0.760854887 ubox
14 22 0.101363707 ubox
14 23 0.341876320 ubox
14 25 0.109585483 ubox
14 27 0.020529887 ubox
14 29 0.003751856 ubox
14 30 0.007167226 ubox
14 31 0.039563270 ubox
14 33 0.025855131 ubox
14 39 0.006880914 ubox
15 19 0.675097434 ubox
15 21 0.107600043 ubox
15 24 0.108619499 ubox
15 26 0.017410389 ubox
15 28 0.003369381 ubox
15 32 0.025426256 ubox
15 35 0.003241611 ubox
15 38 0.006945005 ubox
15 41 0.016178081 ubox
16 21 0.057351833 ubox
16 24 0.013255000 ubox
16 26 0.013383634 ubox
16 28 0.031634027 ubox
16 34 0.003565092 ubox
16 37 0.006654465 ubox
16 40 0.017393887 ubox
16 41 0.007523693 ubox
17 22 0.014234683 ubox
17 23 0.017503427 ubox
17 25 0.017551152 ubox
17 27 0.033349046 ubox
17 29 0.039075508 ubox
17 30 0.004014575 ubox
17 33 0.003410250 ubox
17 39 0.018929924 ubox
18 24 0.017881996 ubox
18 26 0.033555272 ubox
18 28 0.039970045 ubox
18 32 0.003259491 ubox
18 34 0.005528123 ubox
18 38 0.018322701 ubox
18 40 0.034087959 ubox
18 41 0.003349321 ubox
19 23 0.015970090 ubox
19 25 0.033225848 ubox
19 27 0.040064572 ubox
19 29 0.007925414 ubox
19 31 0.003369101 ubox
19 33 0.005774858 ubox
19 39 0.037306444 ubox
20 24 0.029470397 ubox
20 26 0.039628595 ubox
20 28 0.008441311 ubox
20 32 0.005688268 ubox
20 36 0.007341626 ubox
20 37 0.011057788 ubox
20 38 0.037265256 ubox
21 25 0.033005560 ubox
21 27 0.008472017 ubox
21 29 0.003980505 ubox
21 31 0.004666776 ubox
21 39 0.004812653 ubox
22 26 0.007861094 ubox
22 28 0.004171086 ubox
22 35 0.054047518 ubox
22 36 0.026358742 ubox
22 38 0.004716603 ubox
22 41 0.005802093 ubox
23 32 0.004057468 ubox
23 34 0.067844279 ubox
23 35 0.019784891 ubox
23 37 0.004047663 ubox